Chapter 1: Biodiversity scales

1. Write in the course:

Theme 1B: Biodiversity, Outcome and Evolutionary Phase

Chapter 1: Biodiversity scales

How is biodiversity organized?

 

2. Watch the video: Les échelles de la biodiversité. After viewing it, on a blank sheet of paper, write down the main ideas you have selected. Look for at least several minutes before restarting the video to complete or correct your key ideas.

 

3. Among the sequences below, determine if it is the sequences of two genes or two alleles. Justify your answer.

sequence 1 : ATTCGGATCTAGCTAGCTAGCTAGCTAG

sequence 2 : ATACGGATCTAGCTAGCTAGCTAGCTAG

 

4. Finaly,  watch the video : what is an allele ? (if you need, use the subtitles) and write down the following definitions : trait, gene and allele.